90
|
FLIR Systems
flir tools software version 5.13.18031.2002 Flir Tools Software Version 5.13.18031.2002, supplied by FLIR Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/jmp+software+version+5%2C+2002/flir+tools+software/pmc10982437-179-5-10 Average 90 stars, based on 1 article reviews
flir tools software version 5.13.18031.2002 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
FLIR Systems
thermography software thermacam researcher pro 2.10 version 5.13.18031.2002 Thermography Software Thermacam Researcher Pro 2.10 Version 5.13.18031.2002, supplied by FLIR Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/jmp+software+version+5%2C+2002/thermacam+researcher+pro+2+10/pm37364442-87-15-28 Average 90 stars, based on 1 article reviews
thermography software thermacam researcher pro 2.10 version 5.13.18031.2002 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Quelle GmbH
soep 2002 Soep 2002, supplied by Quelle GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/jmp+software+version+5%2C+2002/soep+2002/pm16217719-95-28-27 Average 90 stars, based on 1 article reviews
soep 2002 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
96
|
Vector Laboratories
streptavidin biotin blocking kit Streptavidin Biotin Blocking Kit, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/jmp+software+version+5%2C+2002/Streptavidin%2FBiotin+Blocking+Kit/pm18653773-66-37-40 Average 96 stars, based on 1 article reviews
streptavidin biotin blocking kit - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
90
|
MWG-Biotech ag
arch915 (5′ gtgctcccccgccaattcct 3′) Arch915 (5′ Gtgctcccccgccaattcct 3′), supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/jmp+software+version+5%2C+2002/arch915++5++gtgctcccccgccaattcct++3++/10__1029_slash_2010jg001323-73-22-18 Average 90 stars, based on 1 article reviews
arch915 (5′ gtgctcccccgccaattcct 3′) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
99
|
ATCC
atcc recommendations Atcc Recommendations, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/jmp+software+version+5%2C+2002/Dulbecco's+Modified+Eagle's+Medium/pm22777917-129-6-6 Average 99 stars, based on 1 article reviews
atcc recommendations - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
90
|
CIPAC Ltd
cipac mt 46.3 Cipac Mt 46.3, supplied by CIPAC Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/jmp+software+version+5%2C+2002/cipac+mt+46/10__21608_slash_jppp__2020__96006-46-81-80 Average 90 stars, based on 1 article reviews
cipac mt 46.3 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
99
|
Bio-Rad
907r 907r, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/jmp+software+version+5%2C+2002/SsoAdvanced+Universal+SYBR+Green+Supermix/10__1016_slash_j__gca__2020__02__012-148-13-26 Average 99 stars, based on 1 article reviews
907r - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
98
|
Illumina Inc
nextseq 500 high output kit v2 Nextseq 500 High Output Kit V2, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/jmp+software+version+5%2C+2002/NextSeq+500%2F550+High+Output+Kit+v2%2E5/pm29625068-342-12-21 Average 98 stars, based on 1 article reviews
nextseq 500 high output kit v2 - by Bioz Stars,
2026-10
98/100 stars
|
Buy from Supplier |
99
|
Illumina Inc
truseq rna sample preparation kit v2 Truseq Rna Sample Preparation Kit V2, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/jmp+software+version+5%2C+2002/TruSeq+RNA+Library+Preparation+Kit+v2/pm30670081-96-13-19 Average 99 stars, based on 1 article reviews
truseq rna sample preparation kit v2 - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
94
|
Selleck Chemicals
alimta pemetrexed Alimta Pemetrexed, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/jmp+software+version+5%2C+2002/Pemetrexed/pmc11736037-238-9-7 Average 94 stars, based on 1 article reviews
alimta pemetrexed - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
90
|
Verlag GmbH
hlb system Hlb System, supplied by Verlag GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/jmp+software+version+5%2C+2002/hlb+system/us08686026-92-1-12 Average 90 stars, based on 1 article reviews
hlb system - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |